This year, we went back to Lake Joyce to study the benthic biology in the McMurdo Dry Valleys. The 3D microbial structures that are growing out of the mat are particularly interesting because most of them have a calcite skeleton. This is the only lake in the Dry Valleys where microbial mats have such distinctive calcite skeletons.

The calcite skeleton makes these microbialites particularly interesting for geobiology, where modern microbial mats are studied to enable a better interpretation of microbialite fossils from early Earth. 

Over the last three weeks we collected samples that will allow us to investigate if the water chemistry, light and sedimentation effect the growth of microbialites in the lake. We also collected mat material to carry out DNA and microscopy analysis to evaluate the role that cyanobacteria, other bacteria and eukaryotes play on the formation of microbialites and their calcite skeleton.

Microscopy image of Phormidium cyanobacterial filaments in Lake Joyce mats. Most of the Phormidium filaments have a strong purple pigmentation though the production of Phycoerythrin for a better utilisation of the limited light that is available in Lake Joyce.

Anne working at the microscope.

Close-up image of microbialites with calcite skeleton covered by thin microbial mat webs .

Microbialite structures with calcite skeleton collected from Lake Joyce by diving.

The team getting ready for a dive to collect microbial mats.

The main efforts of the field event led by researchers from UC Davis, California, were to map the distribution of the microbial structures in the lake and to test what the influence of sedimentation is on the microbial structures.

The imaging is done by a drop camera that is held on a rope through a hole in the ice. The team installed several traps in the ice that will collect sediment from now until next season.Each hole is individually drilled with a jiffy drill in order to insert the traps and document the microbial mas and microbial structures.

The team drilling a hole in the ice.

After a day of busy packing, submitting a request for a helicopter and some sequence data analysis, I went for an evening walk. It was a cloudy day and a little chilly as well. Over summer around 1,000 people are at McMurdo station and therefore you can find a little bit of everything that you would also find in any small town or village around the world.

Scott's Discovery Hut and McMurdo Station.

Cary labs, where a lot of the science is happening.

McMurdo shop.

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Here's her final post on cyanobacterial diversity.

Anne is already gearing up to head to Antarctica again! High time I wrap up my mini-series and show you my results. Last time, we sent the cyanobacterial samples for DNA sequencing. This is done in-house at the Museum, so it only takes a few days. Initially, the sequencing files are fairly innocuous - just long strings of letters representing the DNA code.

Here's an example of the first 50 letters of sample 1:

TGGAAACGGAACGCAGTCACATGTTTCGGCTGGACTCAGGGGTATCTAA…

The file continues like this for 770 more base pairs.

To get a first idea of  the easiest way to analyse such data is to carry out a BLAST search. BLAST stand for “basic local alignment search tool” and this is an online resource anyone can use. BLAST compares the uploaded sequences against a vast database.

In my case, the results are all cyanobacteria sequences that scientists have uploaded in the past. Under “query cover” you can see the percentage of identity between the sample and the database entry. In this particular case, we have a number of “uncultured cyanobacteria” entries, which means that somebody uploaded a sequence but didn’t add in much details. But the entry at the bottom shows a 99% match to Chamaesiphon, which is a unicellular cyanobacteria first described in the 1830s.

Different Chamaesiphon genera © 2004–2014 J. Komárek & T. Hauer

Microscopy images of cyanobacteria culture with highest BLAST match to Chamaesiphon.

In the image above you can see the sketch commonly found in scientific books on cyanobacteria for the order Chamaesiphon. Imagine having the microscope image on the top and using the drawings to try and identify the species - they don’t look too similar! Modern sequencing is a powerful tool to identify microorganisms.

However, BLAST results are not always straightforward. At times, the quality of the sequencing result isn’t good enough to carry out a good alignment or a sequence could correspond to more than one database entry. Sometimes, there is no entry to correspond to the uploaded sequence. This means that no similar DNA sequence has been uploaded to the BLAST database, and this may indicate a novel type of cyanobacteria. Therefore, for our case, further detailed phylogenetic analysis are now required to test if our preliminary BLAST result provided a correct assignment of the cyanobacterial isolate to the genus Chamaesiphon.

Microscopy images of cyanbacteria isolates 9 and 13

Some of the other cyanobacterial isolates were samples 9 and 13. Sample 9 was sequenced and had 100% similarity to Phormidium priestleyi, while sample 13 had less certain results. In the case of sample 13, the sequence results itself is of low quality – a lower number of base pairs was analysed, and the signal intensity is very weak. This will either be due a low quality PCR-product or potentially a not pure cyanobacterial isolate.

After sequencing and BLAST, the next step is to carry out a phylogenetic analysis and to discuss the results in context of the metadata e.g. habitat, water chemistry etc to see if there are some common features. But sadly, my time at the Museum is over. I reckon there is still a lot do for another summer student !!!

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Her next post on cyanobacterial diversity is all about DNA lab work.

At the end of my last post, we determined which cyanobacteria isolates were unialgal by microscopy and suitable for DNA analysis. These samples were initially collected during the Antarctic fieldwork featured on this blog, stored, and brought back to the Museum. Now we want to know what type of cyanobacteria we’re dealing with! One method to determine the species is by DNA sequencing. For cyanobacteria it is really important to use DNA analysis, as cyanobacteria have very varible morphologies that can change under under different growth conditions.

Analysing DNA

The first step of preparing the samples is to carry out a DNA extraction. This step destroys the cell wall of cyanobacterial cells, and removes everything but the DNA from the test tube. A cyanobacterial genome is fairly large, around 1-10 megabases. That’s as much information as fits on a CD-ROM! Therefore we want to look only at a smaller section of DNA at this stage. The step after DNA extraction is called a PCR (polymerase chain reaction), which amplifies a small part of the DNA and generates multiple copies of it. We are using a cyanobacteria-specific protocol that only targets the DNA of cyanobacteria.

Sounds straightforwards, right? Well, this summer I was the victim of the PCR ghoul - none of the reactions worked...or rather, they worked too well. Below you can see the results of one of my (many…) failed PCRs. Each white stripe corresponds to the amplified DNA after PCR of each sample. The 'ladders' on each side are the equivalent of rulers to allow you to verify the size of your amplified DNA. Looks pretty good, right? We’ve got a good yield for each reaction!

Wrong - unfortunately, the white stripe on the far right is a negative control. I set up the PCR for that reaction without any DNA, so actually, there shouldn’t be any stripe showing up at all! So what’s going wrong here?

PCR results from Cyanobacteria (16S rRNA gene) isolated from Antarctica and contamination in negative control.

Well, the PCR amplifies only cyanobacteria DNA - so there can be only one explanation for the 'positive' negative control. One of the reagents for the PCR has DNA contamination! The only solution to this is trial-and-error elimination - each reagent must be replaced individually to figure out the culprit. Unfortunately, a PCR reaction requires about 8 different reagents to work, and any one of them could contain a  tiny trace amount of cyanobacterial DNA.

You can imagine that this process takes time, and can at times be disheartening, especially as the contaminants cannot be seen with the naked eye. However, luckily, the PCR ghoul finally released me from my odyssey and my negative control was finally 'negative' without  a white strip, and I was able to send my samples for DNA sequencing. More on the results next time!

PCR results from Cyanobacteria (16S rRNA gene) isolated from Antarctica without contamination.

I have got a few more impressions to share on our camp life. We have an amazing view from our cooking area, out across Lake Fryxell and towards Mt Erebus in the background.

View while cooking

We brought a lot of equipment and some days the camp is turned into a workshop to get everything installed, assembled, checked and running for our measurements in the lake.

Preparing equipment for measurements in lake

Another important task is to keep the heater running in the camp.

Lighting the heater

As I wrote previously, all our microbial mat samples are collected by the divers in our team. AND the divers are back in the water! The diving is happening through a hole in the ice. It takes several days to make the hole. First a smaller hole is drilled and then a coil called a hot finger is used to widen the hole to ca 1 m in diameter.

We are not only collecting benthic cyanobacterial mat samples, but the divers are also collecting water from above the microbial mats for nutrient analysis and to determine oxygen concentration, as well as measuring the light conditions under the ice.

The scientific diving at Lake Fryxell is done with surface supplied air and there are always several dive tenders at each dive. Their responsibilities include tendering to the tethered diver or operating the console for the air supply and communication between the tender and diver.

We are getting ready for a dive

My job is dive tender

It is the end of a dive and we are getting the diver out of the water

Full face mask diving set-up

Today, I collected water samples to study the diversity of cyanobacteria found in the water column of Lake Fryxell.  The water is sampled through a hole in the ice. We are very lucky the hole is covered by a heated tent, which makes it a lot easier. 

The phytoplankton biomass is concentrated on a filter. Some of the filters turned orange and brown because of the pigments of the phototrophic microbial community. After my return to the NHM, I will extract the DNA in order to characterise the cyanobacterial diversity.

Water sampling

Niskin bottle

Water filtration set-up

Water filter coloured by the pigments of the phototrophic microbes in Lake Fryxell water

.....and a little quiz: What is wrong in the following pictures?