Back online! We just got back from our wonderful field camp at Lake Joyce and are busy cleaning our camping equipment and repacking equipment and samples for shipping back to our home institutions. Meanwhile, here is an update on what we have been doing during the last few weeks by Lucy Coleman. Lucy is a teacher in California and part of PolarTrec, and in her blog she talks about the science happening on the cyanobacterial mats, microbialites, sampling, and camp life.

PolarTrec is an amazing programme that allows teachers and researchers to come together through hands-on field experience in Antarctica. It is great to have a chance to work together and learn about teaching, education and outreach!

               Lucy working on blog, video and image updates that will later be taken back to the station and posted online.

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Here's her final post on cyanobacterial diversity.

Anne is already gearing up to head to Antarctica again! High time I wrap up my mini-series and show you my results. Last time, we sent the cyanobacterial samples for DNA sequencing. This is done in-house at the Museum, so it only takes a few days. Initially, the sequencing files are fairly innocuous - just long strings of letters representing the DNA code.

Here's an example of the first 50 letters of sample 1:

TGGAAACGGAACGCAGTCACATGTTTCGGCTGGACTCAGGGGTATCTAA…

The file continues like this for 770 more base pairs.

To get a first idea of  the easiest way to analyse such data is to carry out a BLAST search. BLAST stand for “basic local alignment search tool” and this is an online resource anyone can use. BLAST compares the uploaded sequences against a vast database.

In my case, the results are all cyanobacteria sequences that scientists have uploaded in the past. Under “query cover” you can see the percentage of identity between the sample and the database entry. In this particular case, we have a number of “uncultured cyanobacteria” entries, which means that somebody uploaded a sequence but didn’t add in much details. But the entry at the bottom shows a 99% match to Chamaesiphon, which is a unicellular cyanobacteria first described in the 1830s.

Different Chamaesiphon genera © 2004–2014 J. Komárek & T. Hauer

Microscopy images of cyanobacteria culture with highest BLAST match to Chamaesiphon.

In the image above you can see the sketch commonly found in scientific books on cyanobacteria for the order Chamaesiphon. Imagine having the microscope image on the top and using the drawings to try and identify the species - they don’t look too similar! Modern sequencing is a powerful tool to identify microorganisms.

However, BLAST results are not always straightforward. At times, the quality of the sequencing result isn’t good enough to carry out a good alignment or a sequence could correspond to more than one database entry. Sometimes, there is no entry to correspond to the uploaded sequence. This means that no similar DNA sequence has been uploaded to the BLAST database, and this may indicate a novel type of cyanobacteria. Therefore, for our case, further detailed phylogenetic analysis are now required to test if our preliminary BLAST result provided a correct assignment of the cyanobacterial isolate to the genus Chamaesiphon.

Microscopy images of cyanbacteria isolates 9 and 13

Some of the other cyanobacterial isolates were samples 9 and 13. Sample 9 was sequenced and had 100% similarity to Phormidium priestleyi, while sample 13 had less certain results. In the case of sample 13, the sequence results itself is of low quality – a lower number of base pairs was analysed, and the signal intensity is very weak. This will either be due a low quality PCR-product or potentially a not pure cyanobacterial isolate.

After sequencing and BLAST, the next step is to carry out a phylogenetic analysis and to discuss the results in context of the metadata e.g. habitat, water chemistry etc to see if there are some common features. But sadly, my time at the Museum is over. I reckon there is still a lot do for another summer student !!!

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Her next post on cyanobacterial diversity is all about DNA lab work.

At the end of my last post, we determined which cyanobacteria isolates were unialgal by microscopy and suitable for DNA analysis. These samples were initially collected during the Antarctic fieldwork featured on this blog, stored, and brought back to the Museum. Now we want to know what type of cyanobacteria we’re dealing with! One method to determine the species is by DNA sequencing. For cyanobacteria it is really important to use DNA analysis, as cyanobacteria have very varible morphologies that can change under under different growth conditions.

Analysing DNA

The first step of preparing the samples is to carry out a DNA extraction. This step destroys the cell wall of cyanobacterial cells, and removes everything but the DNA from the test tube. A cyanobacterial genome is fairly large, around 1-10 megabases. That’s as much information as fits on a CD-ROM! Therefore we want to look only at a smaller section of DNA at this stage. The step after DNA extraction is called a PCR (polymerase chain reaction), which amplifies a small part of the DNA and generates multiple copies of it. We are using a cyanobacteria-specific protocol that only targets the DNA of cyanobacteria.

Sounds straightforwards, right? Well, this summer I was the victim of the PCR ghoul - none of the reactions worked...or rather, they worked too well. Below you can see the results of one of my (many…) failed PCRs. Each white stripe corresponds to the amplified DNA after PCR of each sample. The 'ladders' on each side are the equivalent of rulers to allow you to verify the size of your amplified DNA. Looks pretty good, right? We’ve got a good yield for each reaction!

Wrong - unfortunately, the white stripe on the far right is a negative control. I set up the PCR for that reaction without any DNA, so actually, there shouldn’t be any stripe showing up at all! So what’s going wrong here?

PCR results from Cyanobacteria (16S rRNA gene) isolated from Antarctica and contamination in negative control.

Well, the PCR amplifies only cyanobacteria DNA - so there can be only one explanation for the 'positive' negative control. One of the reagents for the PCR has DNA contamination! The only solution to this is trial-and-error elimination - each reagent must be replaced individually to figure out the culprit. Unfortunately, a PCR reaction requires about 8 different reagents to work, and any one of them could contain a  tiny trace amount of cyanobacterial DNA.

You can imagine that this process takes time, and can at times be disheartening, especially as the contaminants cannot be seen with the naked eye. However, luckily, the PCR ghoul finally released me from my odyssey and my negative control was finally 'negative' without  a white strip, and I was able to send my samples for DNA sequencing. More on the results next time!

PCR results from Cyanobacteria (16S rRNA gene) isolated from Antarctica without contamination.

This afternoon we went for a walk on the Lake Fryxell. The ice is incredible clear in the moat regions, and one can find everywhere cyanobacterial mats frozen into the ice. These cyanobacterial mats were originally from the bottom of the lake, and are called lift-off mats. Microbial mats often drift to the top of the water when they are pushed upwards through the formation of gas bubbles. Although mats are now frozen, it is very likely that many of the cyanobacteria in the mats are still viable.

Lake Fryxell with Canada Glacier in the background

Dried cyanobacterial mats in the ice

Most of the cyanobacterial mats that we have found were orange pigmented and the macroscopic structure was flaky to cohesive. The orange colour is due to carotenoids which are an protection against UV and oxidative stress.

I had a small light micrscope with me in the field and the genus Leptolyngbya dominated the orange mats. Leptolyngbya are filamentous non-branching cyanobacteria belonging to the order Oscillatoriales. They are mostly between 0.5-3 micrometre thick. However, the lower side of the orange layers sometimes had green pigmentation, which besides the Leptolyngbya also had some Phormidium. The genus Phormidium also belong to the order Oscillatoriales, but they are thicker with a width of around 5 micrometres.

   Flaky orange-pigmented cyanobacterial mats dominated by Leptolyngbya

Cohesive orange-pigmented cyanobacterial mats

green lower side of cyanobacterial mat with Phormidium

Interestingly, we also found some cyanobacterial mats which were dark purple to black. This colour is due to the UV-screening Scytonemin. We found the genus Schizothrix sp. (Oscillatoriales)  in the mats which is known to produce Scytonemin. We also found several ponds with large accumulations of the genus Nostoc, which belongs to the order Nostocales and has specialist cells called heterocysts for nitrogen-fixation.

Cyanobacterial mats with the Scytonemin-producing genus Schizothrix

Nostoc accumulations in a meltwater pond

We also found a few ponds with green algae. Green algae biofilms are easy to distinguish from cyanobacteria as green algae are very bright green.

Green algae

There are many small ponds and lakes at Cape Evans, similar to Cape Royds . After a quick survey of the ponds, we concentrated on five ponds for sampling. We sampled for morphological, DNA- and RNA-based analysis of the cyanobacterial diversity, as well as nutrient analysis of the water.

Cyanobacterial mats in Skua Lake

Large cyanobacterial mat accumulations

Cyanobacterial mat with a pink layer of purpil bacteria  at the bottom

Water sampling at a small pond at Cape Evans

Yesterday we sampled cyanobacterial mats and water samples on the McMurdo Ice Shelf. We went for the day to an area near Bratina Island. In this area, the ice shelf  is covered with a  layer of sediment and hundreds of meltwater ponds can be found. During the summer they forms a large network of meltwater ponds  and it has the most extensive microbial growth and largest non-marine biota in southern Victoria Land. It  has been suggested that the  area plays an important role as  source for inocula through dispersal by winds into the more extreme regions such as the Dry Valleys.

Although some of the ponds are only several meters away from each other , they can have very different characteristics. A large range of salinities can be found in the area ranging from fresh to hypersaline.

                        McMurdo Ice Shelf and Bratina Island with Royal Society Range in the background

   Temperature, conductivity and ph measurements at an hypersaline pond near Bratina Island. The pond is called Salt Pond and has thick white salt crust around the water edge.

                                  Cyanobacterial mats with orange pigmented pinnacles