Hallo to everybody,
I am interested in house dust mites, but I have problems with description
of Dermatophagoides genus mites, especially D. evansi and D. chelidonis.
Maybe anybody can help me.
Thanks in advance.
Aurelija
-----------------------------
Aurelija Dautartiene
Dept. of Zoology
Faculty of Natural Sciences
Vilnius University
Ciurlionio str. 21/27
Vilnius 2009,
Lithuania
fax. +370 2 330 068

>
>
> > Dear Aurelija,
> >
> > You can try these references:
> >
> > 1) van Bronswijk & Sinha (1971) Pyroglyphid mites (Acari) and house
> > dust allergy -  review. Journal of Allergy 47(1):31-52
> >
> > 2) Colloff & Spieksma (1992) Pictorial keys for the identification of
> > domestic mites. Clinical Experimental Allergy 22:823-30
> >
>
> Celso H OLiveira
> Campinas - SP
> Brazil
>
> >
> >
> >
> >
> > Aurelija Dautartiene wrote:
> >
> >> Hallo to everybody,
> >> I am interested in house dust mites, but I have problems with
> >> description
> >> of Dermatophagoides genus mites, especially D. evansi and D.
> >> chelidonis.
> >> Maybe anybody can help me.
> >> Thanks in advance.
> >> Aurelija
> >> -----------------------------
> >> Aurelija Dautartiene
> >> Dept. of Zoology
> >> Faculty of Natural Sciences
> >> Vilnius University
> >> Ciurlionio str. 21/27
> >> Vilnius 2009,
> >> Lithuania
> >> fax. +370 2 330 068

For attention of Eduardon Ruiz of Madrid

Have tried to e-mail you direct but your address
edruiz@eucmax.sim.ucm.es failed.

Please contact me

Roy Whitehead
BRESSAY Shetland  ZE2  9ER
UK

roy-whitehead@supanet.com

We need some help from anyone in the list...
We are looking for anyone who knows about Pyemotes or Pediculoides acari,
as alergic agents...
This is about a consult we have from a dermatology doctor.
Sincerely,
 

  _________________________
|     EDUARDO RUIZ        |
| Dep. Biologia Animal I  |
| Facultad de Biologia    |
| Universidad Complutense |
|    28040 - MADRID       |
|edruiz@eucmax.sim.ucm.es |
|_________________________|

To
acarology@nhm.ac.uk

 Would anyone in the acarological world be kind enough to send me a copy of
the following publications :
Udvardy, M.D.F. 1975.  A classification of the biogeographical provinces of
the world. IUCN Occasional Paper No. 18, IUCN, Glands.

Thanking you in expectation

Yours faithfully
 

Dr. Asit K. Bhattacharyya
Desert regional Station
Zoological Survey of India
Jhalamand, Pali road
Jodhpur 342 005
Rajasthan, iNDIA
Telephone : + 0291 740 540, + 0291 746 213
Telefax : + 0291 748 551
E-mail : asitzsi@usa.net
 

I would like to thank everybody for the overwhelming response to my email about "tick".
I just released the creature near my house after taking departing pictures:

the creature is wrestling with a ruler while i'm taking the picture:
http://biol.net/pseudoscor_WWF.JPG

sizing up a Post-it:
http://biol.net/pseudoscor_ruler.JPG

TNX
VM
 

Barry M. OConnor
Curator & Professor             phone: (734) 763-4354
Museum of Zoology               FAX: (734) 763-4080
University of Michigan          e-mail: bmoc@umich.edu
Ann Arbor, MI 48109-1079  USA

Please reply to mogila@biol.net

From: mogila@biol.net=20
To: acarology@nhm.ac.uk=20
Subject: can you identify a tick from the picture?
Date: Wed, 13 Jun 2001 18:53:17 -0500

hi everybody
today i found a tick (i guess, it has 4 pairs of legs) on my clothes in =
Harvard Yard in Cambridge. Can anybody identify it from a picture i took.
I placed the picture on the site biol.net
the link is:
http://biol.net/tick_5mm.JPG=20

it does not look like any ticks i remember from by biology courses.

Thank you for any response
VM

Dear Colleagues,
Can anybody help me with the descriptions of the following oribatid species:

1) Papillacarus lienhardi Mahunka, 1997
in: Oribatids from Brunei II (Acari, Oribatida) (Acarologica Genavensi LXXXIII)

2) Papillacarus echinatus Li & Chen, 1991
in: A new species of Papillacarus from Chongquing, China (Oribatida:
Lohmanniidae)  - This article is in Chinese, but the figure will do.

Thank you in advance
Louise Coetzee
 

----------------------------------------------------------
Louise Coetzee         Tel: + 27 51 4479609
Dept of Acarology      Fax: + 27 51 4476273
National Museum        acarol@nasmus.co.za
P.O. Box 266           www.nasmus.co.za
Bloemfontein
9300 South Africa
 

I would like to find updated text(s) pertaining to taxonomy of mites,
preferably tree/shrub oriented, specifically focused in the Midwest region of
the United States. Thanks!

Ty Rankin
Plant Biologist/Horticulturist
Green Bay, WI, USA

Dear Sir/ Madam,
Would anyone in the acarological world be kind enough to send me the reprints/
photocopies of the following articles. I tried my level best to collect these
reprints but without any result. My postal address is given below.
1. Evans, G.O. & Hyatt, K.H. 1960. A revision of the Platyseiinae
(Mesostigmata : Aceosejidae) based on the material in the collection of the
British Museum (Natural History). Bull. Br. Mus. nat. Hist. (Zool.), 6 : 27 -
101.
2. Evans, G.O. & Purvis, G. 1987. A new ascid mite from St. Helena with
observations on the Protogamasellus complex (Acari : Mesostigmata). J. nat.
Hist., 26(4) : 855 - 861.

3. Bernhard, F. 1963. Die familie Ascidae (Oudemans, 1905) Bernhard nov. comb.
In : Beitrage zur systematil and Oekologie mitteeuropaischer. Acarina Band 2.
Mesostigmata 1, Section 3, (ed. Stammer, H.J.), Geest & Poritz, Leipzig : 33 -
177.
4. Evans, G.O. & Hyatt, K.H. 1960. A revision of the Platyseiinae
(Mesostigmata : Aceosejidae) based on the material in the collection of the
British Museum (Natural History). Bull. Br. Mus. nat. Hist. (Zool.), 6 : 27 -
101.
5. Evans, G.O. & Purvis, G. 1987. A new ascid mite from St. Helena with
observations on the Protogamasellus complex (Acari : Mesostigmata). J. nat.
Hist., 26(4) : 855 - 861.
6. Jordann, L.C. 1988. Gamasellodes hildae (Acari : Ascidae), a new species
from South africa. Phytophylactica, 20(1) : 39 - 41.
7. Makarova, O.L. & Petrova, A.D. 1992. Gamasid mites of the genus Arctoseius
Thor, 1930 (Mesostigmata : Aceosejidae) of the eastern Palearctic. I. Species
of the cetratus group. Biol. Nauki (Mosc.), 3 : 28- 40.
8. Gu, Y., wang, J.c. & Huang, C. 1990. Six new species of the genus
Lasioseius (Acari : Aceosejidae). Acta Zootaxonomica Sin., 15(2) : 174 - 184.

Please contact me directly at my E-mail address.
Waiting for your kind reply
 

Dr. Asit K. Bhattacharyya
Desert regional Station
Zoological Survey of India
Jhalamand, Pali road
Jodhpur 342 005
Rajasthan, iNDIA
Telephone : + 0291 740 540, + 0291 746 213
Telefax : + 0291 748 551
E-mail : asitzsi@usa.net

Dear Ann,
 

Find enclosed a list of mites related to poultry in Brazil according to
Flechtmann, 1973.
 

Lots of fun,
 

Celso H Oliveira, MD MPhil
State University of Campinas - UNICAMP
Campinas, SP
oliveira-ch@uol.com.br
 
 

Ann DERNBURG wrote:

> Good day to all. I sent this request over the net several weeks ago:
> "I recently joined a research team that is working on poultry mites. Could
> I appeal to you acariologists WORLDWIDE to write back and tell me which
> species are found in your country? In particular, do you have Dermanyssus
> gallinae or Ornithonyssus syviarum? Are they economically important?"
>
> So far, I have received responses from South Africa, Brazil, Australia, and
> France. The two mites common to all are Dermanyssus gallinae and
> Ornithonyssus sylviarum, but O. bursa and Argas miniatus have also been
> named. A priori, continental Europe has mostly been affected by D.
> gallinae, but we've found O. sylviarum in several commercial flocks in
> France. I also know, from the literature, that the "infamous 2" occur in
> north America and Great Britain.
>
> I'd like to complete this picture. Could I prevail upon you to pass this
> request on to your veterinary parasitology and acariology acquaintances? I
> will summarize the responses again (and then I'll quit pestering you with
> this question!)
>
> Thanks,
> Ann
>
> Ann Dernburg
> Maître de Confèrences
> Unité de Ethnologie, Zootechnie, et Economie Rurale
> Ecole Nationale Vétérinaire de Lyon
> 1 Ave. Bourgelat
> B.P. 83
> 69280 Marcy l'Etoile
> tel: 04 78 87 27 87
> fax/sécrétariat: 04 78 87 26 67
 
 

-----Mensaje original-----
De: Lic. Judith Mendiola [SMTP:mendiola@ipk.sld.cu]
Enviado el: Miércoles 6 de Junio de 2001 3:22 PM
Para: 'acarology@nhm.ac.uk'
Asunto:

Dear colleagues,
I'm working on Boophilus microplus embryogenesis and I'm looking for information.
Would anyone send me references and/or reprints about tick embryogenesis histology?
Thanks in advance.
Regards,
 

Judith Mendiola, mendiola@ipk.sld.cu
Aymée Fernández-Calienes  ayme@ipk.sld.cu

A. R. Chittenden, Y. Saito:
Why are there feeding and nonfeeding larvae in phytoseiid mites
(Acari, Phytoseiidae)?
J Ethol 19 (2001) 1, 55-62
URL:
http://link.springer.de/link/service/journals/10164/bibs/1019001/10190055.htm
or
URL:
http://link.springer-ny.com/link/service/journals/10164/bibs/1019001/10190055.htm
 

H. Yanagida, Y. Saito, K. Mori, A. R. Chittenden:
Egg-depositing behavior as a predator avoidance tactic of Yezonychus
sapporensis Ehara (Acari, Tetranychidae)
J Ethol 19 (2001) 1, 63-66
URL:
http://link.springer.de/link/service/journals/10164/bibs/1019001/10190063.htm
or
URL:
http://link.springer-ny.com/link/service/journals/10164/bibs/1019001/10190063.htm
--
ACCGTCCGTAGCATGCCGTRATATATATATCGATTTACGTATATCTCGAACGGTATATAGCATACG

Rich Patrock, Post-doctoral Associate        1405 W. North Loop #116
Brackenridge Field Laboratories                 Austin, TX.  78756
Fire Ant Laboratory                                        (512) 374-9741
Section of Integrative Biology-C0930
School of Biological Sciences
University of Texas at Austin
Austin, TX  78712                                       _
           (512) 471-2114                            _  |     ~-.
FAX:  (512) 475-6286                           \,       *_ }
patrock@mail.utexas.edu                           \ (
http://www.utexas.edu/research/bfl/

TGGCAGGCATCGTACGGCATSATATATATAGCTAAATGCATATAGAGCTTGCCATATATCGTATGC

Be sure you are right, then go ahead.
               The motto of David Crockett in the war of 1812.

Good day to all. I sent this request over the net several weeks ago:
"I recently joined a research team that is working on poultry mites. Could
I appeal to you acariologists WORLDWIDE to write back and tell me which
species are found in your country? In particular, do you have Dermanyssus
gallinae or Ornithonyssus syviarum? Are they economically important?"

So far, I have received responses from South Africa, Brazil, Australia, and
France. The two mites common to all are Dermanyssus gallinae and
Ornithonyssus sylviarum, but O. bursa and Argas miniatus have also been
named. A priori, continental Europe has mostly been affected by D.
gallinae, but we've found O. sylviarum in several commercial flocks in
France. I also know, from the literature, that the "infamous 2" occur in
north America and Great Britain.

I'd like to complete this picture. Could I prevail upon you to pass this
request on to your veterinary parasitology and acariology acquaintances? I
will summarize the responses again (and then I'll quit pestering you with
this question!)

Thanks,
Ann

Ann Dernburg
Maître de Confèrences
Unité de Ethnologie, Zootechnie, et Economie Rurale
Ecole Nationale Vétérinaire de Lyon
1 Ave. Bourgelat
B.P. 83
69280 Marcy l'Etoile
tel: 04 78 87 27 87
fax/sécrétariat: 04 78 87 26 67

Dear acarologists,

I'm looking for information on the reported human cases of Lyme disaease in
Europe and the prevalence of infected ticks per country or region.

Thanks in advance

Maxime Madder

Dr. Maxime Madder
Institute of Tropical Medicine
Nationalestraat 155
B-2000 Antwerp
Belgium
tel + 32 3 247.63.97
fax + 32 3 247.62.68
mmadder@itg.be

Dear colleagues,
I'm working on Boophilus microplus embryogenesis and I'm looking for information.
Would anyone send me references and/or reprints about tick embryogenesis histology?
Thanks in advance.
Regards,
 

Judith Mendiola

Dear acarologists,

Can anyone help me with a copy of this paper?

Parameswaran Pillai, P. R. 1957. Pests of stored fish and prawns. Bulletin
of the Research Institute, University of Kerala 5C (3), 1-79 + Plates 1-2.

My inquiries in India have not been successful. Many thanks.

Bruce Halliday

***********************************************************
Dr. R. B. Halliday
CSIRO Entomology
GPO Box 1700
Canberra ACT 2601
Australia

Telephone (02) 6246 4085
Mobile 0438 543509
International Telephone (61) (2) 6246 4085
Fax (02) 6246 4000
International Fax (61) (2) 6246 4000

E-mail bruceh@ento.csiro.au
http://www.ento.csiro.au/research/natres/natres.html
***********************************************************
 

*** This is messaged forwarded by list-owner. Please reply to: ramdai@juno.com

Please reply directly to MARVANN@aol.com
_____________________________________________
From: MARVANN@aol.com
Date: Sat, 2 Jun 2001 19:57:50 EDT
Subject: Need Help
To: acarology@nhm.ac.uk

My wife is continually being bitten by mites, microscopic black specks on her
skin.  We tried to remove them with alcohol, but that does not seem to work.
She has definite marks, open wounds from this critters.  We used all kinds of
insecticides and insect repellents, but nothing seem to stop the bites and
itching.  We've been to doctors, who offer no help, since they have never
heard of anyone being bitten and so allergic to these mites. Please HELP!

To: acarology@nhm.ac.uk
Date: Sat, 02 Jun 2001 00:03:33 -0700
From: "cheryl singidas" <sintosinto@lycos.com>
Subject:  I need help for mite identification!

Dear respected acarologists,
   I am an incoming 4th yr. B.S. Biology student from the University of the Philippines Mindanao Campus. My thesis is about the collection and identification of ectoparasites of the Philippine Eagle. I've isolated two possible species of feather mites. The problem is I couldn't identify them based on what I've researched in the internet and textbooks.
   In connection to this, I am asking for your assistance to help me identify those feather mites up to the species level. I had pictures of already been mounted feather mites. I'll be sending them to you all through the internet upon your confirmation.
   Thank you and good day.
 

Get 250 color business cards for FREE!
http://businesscards.lycos.com/vp/fastpath/

Hello all!

I am a researcher from the Parasitology Division of  Cuban Tropical Medicine Institute Pedro Kourí. We are organizing an event about Vector Control.
All colleagues working in Entomology and Acarology are invited to participate with us.
Please, look for information in our web site:

http://www.sld.cu/eventos/aedes/simposio.htm

We will be very happy to receive you.
Thanking in advance your kind attention,

Sincerely,
Lic. Judith Mendiola

To everyone I just e-mailed,
You would think that graduate students would be smarter than this, but
apparently that is not the case. No more than 30 seconds after sending
the first e-mail to you all, I got an e-mail from the original grad
student saying the virus was a hoax. So no need to delete the file I
suppose. Anyway, sorry for this second inconveience. It has already been
one of those days.
Bradley

To everyone I have e-mailed in the last month,
I just received word from a fellow graduate student that she may have
passed on a computer virus to people she has recently e-mailed. I
searched for the program and sure enough, it was on my hard drive. In
light of that, I suggest you do the following: in Windows press the
START button and go to "Find Files." The name of the virus is
SULFNBK.EXE, so type that in and search for the file. If you find it,
send it to the Recycling Bin and then empty the bin. That will take care
of the problem. Sorry for the inconvenience and take care.
Cheers,
Bradley Tompkins