Skip navigation
1 2 Previous Next

Exploring cyanobacterial diversity in Antarctica Blog

24 Posts tagged with the cyanobacteria tag
0

This year, we went back to Lake Joyce to study the benthic biology in the McMurdo Dry Valleys. The 3D microbial structures that are growing out of the mat are particularly interesting because most of them have a calcite skeleton. This is the only lake in the Dry Valleys where microbial mats have such distinctive calcite skeletons.

 

The calcite skeleton makes these microbialites particularly interesting for geobiology, where modern microbial mats are studied to enable a better interpretation of microbialite fossils from early Earth. 

 

Over the last three weeks we collected samples that will allow us to investigate if the water chemistry, light and sedimentation effect the growth of microbialites in the lake. We also collected mat material to carry out DNA and microscopy analysis to evaluate the role that cyanobacteria, other bacteria and eukaryotes play on the formation of microbialites and their calcite skeleton.

 

cyano.jpg

Microscopy image of Phormidium cyanobacterial filaments in Lake Joyce mats. Most of the Phormidium filaments have a strong purple pigmentation though the production of Phycoerythrin for a better utilisation of the limited light that is available in Lake Joyce.

 

blog4_small.jpg

Anne working at the microscope.

 

Untitled-1.jpg

Close-up image of microbialites with calcite skeleton covered by thin microbial mat webs .

 

blog3.jpg

Microbialite structures with calcite skeleton collected from Lake Joyce by diving.

 

blog7.jpg

The team getting ready for a dive to collect microbial mats.

 

The main efforts of the field event led by researchers from UC Davis, California, were to map the distribution of the microbial structures in the lake and to test what the influence of sedimentation is on the microbial structures.

 

The imaging is done by a drop camera that is held on a rope through a hole in the ice. The team installed several traps in the ice that will collect sediment from now until next season.Each hole is individually drilled with a jiffy drill in order to insert the traps and document the microbial mas and microbial structures.

 

blog2.jpg

The team drilling a hole in the ice.

0

Back online! We just got back from our wonderful field camp at Lake Joyce and are busy cleaning our camping equipment and repacking equipment and samples for shipping back to our home institutions. Meanwhile, here is an update on what we have been doing during the last few weeks by Lucy Coleman. Lucy is a teacher in California and part of PolarTrec, and in her blog she talks about the science happening on the cyanobacterial mats, microbialites, sampling, and camp life.

 

PolarTrec is an amazing programme that allows teachers and researchers to come together through hands-on field experience in Antarctica. It is great to have a chance to work together and learn about teaching, education and outreach!

 

                                   Polartrec.jpg

               Lucy working on blog, video and image updates that will later be taken back to the station and posted online.

0

Departure for Antarctica

Posted by Anne D Jungblut Nov 17, 2014

After spending several lovely days in Christchurch and having a look around to see how more and more buidlings are being rebuilt after the earthquake, it was time to pick up my ECW (Extreme Cold Weather Gear) for our Ice Flight.

 

IMG_0538.jpg

Entrance to the US Antarctic Program clothing distriubtion center in Christchurch.


IMG_0537.jpg

Extreme Cold Weather Gear.

 

The flight was originally scheduled for 9am with a pick-up by the shuttle bus at 6am from the place I was staying. However, weather conditions can change very quickly in Antarctica, therefore I was told to ring the flight information… lucky I did so at 5.40 am.

 

Our flight was delayed by 3 hours, which meant I got another 2 hours of sleep. Finally, we left Christchurch just after 12 noon. As always, the C17 was pretty full with people and cargo.

 

IMG_0552.jpg

Inside the C17 aircraft.

 

After a bit more than 5 hours, we arrived in Antarctica!

 

IMG_0555.jpg

....arrival in Antarctica!

0

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Here's her final post on cyanobacterial diversity.


Anne is already gearing up to head to Antarctica again! High time I wrap up my mini-series and show you my results. Last time, we sent the cyanobacterial samples for DNA sequencing. This is done in-house at the Museum, so it only takes a few days. Initially, the sequencing files are fairly innocuous - just long strings of letters representing the DNA code.

 

Here's an example of the first 50 letters of sample 1:

 

TGGAAACGGAACGCAGTCACATGTTTCGGCTGGACTCAGGGGTATCTAA…

 

The file continues like this for 770 more base pairs.

 

To get a first idea of  the easiest way to analyse such data is to carry out a BLAST search. BLAST stand for “basic local alignment search tool” and this is an online resource anyone can use. BLAST compares the uploaded sequences against a vast database.

 

In my case, the results are all cyanobacteria sequences that scientists have uploaded in the past. Under “query cover” you can see the percentage of identity between the sample and the database entry. In this particular case, we have a number of “uncultured cyanobacteria” entries, which means that somebody uploaded a sequence but didn’t add in much details. But the entry at the bottom shows a 99% match to Chamaesiphon, which is a unicellular cyanobacteria first described in the 1830s.

 

resize-13-11-14-1.jpg

Different Chamaesiphon genera © 2004–2014 J. Komárek & T. Hauer

 

resize-13-11-14-2.jpg

Microscopy images of cyanobacteria culture with highest BLAST match to Chamaesiphon.

 

 

In the image above you can see the sketch commonly found in scientific books on cyanobacteria for the order Chamaesiphon. Imagine having the microscope image on the top and using the drawings to try and identify the species - they don’t look too similar! Modern sequencing is a powerful tool to identify microorganisms.

 

However, BLAST results are not always straightforward. At times, the quality of the sequencing result isn’t good enough to carry out a good alignment or a sequence could correspond to more than one database entry. Sometimes, there is no entry to correspond to the uploaded sequence. This means that no similar DNA sequence has been uploaded to the BLAST database, and this may indicate a novel type of cyanobacteria. Therefore, for our case, further detailed phylogenetic analysis are now required to test if our preliminary BLAST result provided a correct assignment of the cyanobacterial isolate to the genus Chamaesiphon.

 

Sample9.jpg Samples13.jpg

 

 

 

 

 

 

 

 

 

Microscopy images of cyanbacteria isolates 9 and 13

 

 

 

 

 

Some of the other cyanobacterial isolates were samples 9 and 13. Sample 9 was sequenced and had 100% similarity to Phormidium priestleyi, while sample 13 had less certain results. In the case of sample 13, the sequence results itself is of low quality – a lower number of base pairs was analysed, and the signal intensity is very weak. This will either be due a low quality PCR-product or potentially a not pure cyanobacterial isolate.

 

After sequencing and BLAST, the next step is to carry out a phylogenetic analysis and to discuss the results in context of the metadata e.g. habitat, water chemistry etc to see if there are some common features. But sadly, my time at the Museum is over. I reckon there is still a lot do for another summer student !!!

1

The days are getting shorter in London and the Museum's Ice Rink has opened, but this also means that the days are getting longer in Antarctica with the austral summer approaching. This year, I am very lucky to be invited to join an Antarctic expedition to carry out field work at Lake Joyce, a perennially ice-covered lake in McMurdo Dry Valleys.

 

While I am still packing the cargo and organsing how many woollen and thermal socks I need, half of the team is already there. This year our field work is part of the US Antarctic Program and our main station is McMurdo Station on Ross Island. Here's a webcam with a view over McMurdo.

 

We will continue our work on microbial diversity and the ecology of benthic cyanobacteria-based microbialite structures to better understand why and how microbialite structures are forming in Antarctic lakes.

 

10417432_10152512479986716_9214183549648726010_n.jpg

US Antarctic Program bag tags and travel documents.

 

IMG_4240.jpg

Perennially ice-covered Lake Joyce and Taylore Glacier in the Pearse Valley, McMurdo Dry Valleys, Antarctica.

0

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Her next post on cyanobacterial diversity is all about DNA lab work.

 

At the end of my last post, we determined which cyanobacteria isolates were unialgal by microscopy and suitable for DNA analysis. These samples were initially collected during the Antarctic fieldwork featured on this blog, stored, and brought back to the Museum. Now we want to know what type of cyanobacteria we’re dealing with! One method to determine the species is by DNA sequencing. For cyanobacteria it is really important to use DNA analysis, as cyanobacteria have very varible morphologies that can change under under different growth conditions.

 

Analysing DNA

 

The first step of preparing the samples is to carry out a DNA extraction. This step destroys the cell wall of cyanobacterial cells, and removes everything but the DNA from the test tube. A cyanobacterial genome is fairly large, around 1-10 megabases. That’s as much information as fits on a CD-ROM! Therefore we want to look only at a smaller section of DNA at this stage. The step after DNA extraction is called a PCR (polymerase chain reaction), which amplifies a small part of the DNA and generates multiple copies of it. We are using a cyanobacteria-specific protocol that only targets the DNA of cyanobacteria.

 

Sounds straightforwards, right? Well, this summer I was the victim of the PCR ghoul - none of the reactions worked...or rather, they worked too well. Below you can see the results of one of my (many…) failed PCRs. Each white stripe corresponds to the amplified DNA after PCR of each sample. The 'ladders' on each side are the equivalent of rulers to allow you to verify the size of your amplified DNA. Looks pretty good, right? We’ve got a good yield for each reaction!

 

Wrong - unfortunately, the white stripe on the far right is a negative control. I set up the PCR for that reaction without any DNA, so actually, there shouldn’t be any stripe showing up at all! So what’s going wrong here?

 

pos neg control blog.jpgPCR results from Cyanobacteria (16S rRNA gene) isolated from Antarctica and contamination in negative control.

 

Well, the PCR amplifies only cyanobacteria DNA - so there can be only one explanation for the 'positive' negative control. One of the reagents for the PCR has DNA contamination! The only solution to this is trial-and-error elimination - each reagent must be replaced individually to figure out the culprit. Unfortunately, a PCR reaction requires about 8 different reagents to work, and any one of them could contain a  tiny trace amount of cyanobacterial DNA.

 

You can imagine that this process takes time, and can at times be disheartening, especially as the contaminants cannot be seen with the naked eye. However, luckily, the PCR ghoul finally released me from my odyssey and my negative control was finally 'negative' without  a white strip, and I was able to send my samples for DNA sequencing. More on the results next time!

 

PCR blog.jpg

PCR results from Cyanobacteria (16S rRNA gene) isolated from Antarctica without contamination.

0

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. She shares her experience of working in the lab with some very chilly samples.

 

My name is Josi and I'm in the middle of a summer studentship here at the Museum. I have been working with Dr Anne Jungblut on her cyanobacteria project and would love to share what I've been doing over the last several weeks at the Museum.

 

My summer project is supported by funding from the British Phycological Society, which focuses on research on microalgae, seaweeds, cyanobacteria etc. The society supports research projects through grants and has a biannual publication called The Phycologist.

 

Antarctic samples

 

One of my responsibilities over the summer has been to take care of the cyanobacteria in Anne's cyanobacteria culture collection. In the lab, biological samples, or cultures, need to grow in conditions similar to their natural habitats. This keeps them alive and allows us to carry out experiments even when the organisms have been removed from their orginal sites. For example, some of the cyanobacteria samples were collected during Antarctic expeditions featured on this blog and they are now kept in growth chambers here at the Museum.

 

pic1.jpg

Growth chamber for Antarctic cyanobacteria.

 

In the photo, you can see one of these growth chambers or illuminators with each cyanobacteria sample on its separate media place. The bright light on the inside of the door always stays on - it allows the cyanobacteria to carry out photosynthesis. I think of this illuminator as a "cyanobacteria garden" where we wait for the samples to grow. As these cyanobacteria are used to growing under Antarctic conditions, they are quite hardy! But every half year or so the cyanobacteria need to be re-cultured. This process of transferring cells to new medium provides them with fresh nutrients to grow.

 

I also used light microscopy to figure out if the samples are uni-algal - whether they are only one cyanobacterium morphotype or still a mixture of cyanobacteria. This is important because we can only use them for DNA characerisation when they are unialgal.

 

pic2.jpgMicroscopy image of unialgal cyanobacteria culture (L) and mixed sample with unicellular and filamentous cyanobacteria (R).

1

This afternoon we went for a walk on the Lake Fryxell. The ice is incredible clear in the moat regions, and one can find everywhere cyanobacterial mats frozen into the ice. These cyanobacterial mats were originally from the bottom of the lake, and are called lift-off mats. Microbial mats often drift to the top of the water when they are pushed upwards through the formation of gas bubbles. Although mats are now frozen, it is very likely that many of the cyanobacteria in the mats are still viable.

 

Lake Fryxell with Canada Glacier in the background

lake1.jpg

 

 

Dried cyanobacterial mats in the ice

lake2.jpg

4

It is November 2012 and it is time to head back to Antarctica. This year we are a team of researchers and students from University of Canterbury (NZ), UC Davis (USA) and the Natural History Museum, London. We are coming from the research areas of Microbial Biodiversity, Microbial Ecology and Geobiology. We will be working in the McMurdo Dry Valleys and study the benthic biology of Lake Fryxell and Lake Vanda. In total, we will be in Antarctica seven weeks, two weeks at Lake Fryxell and three weeks at Lake Vanda, which is very exciting !

 

Cyanobacteria-based microbial mats and microbialites cover large parts of these lakes. The lakes are ice-covered and meromictic with a stratified water column, which makes them very interesting systems to study how environmental conditions affect microbial diversity and community composition and microbialite morphologies and their assemblages. The microbial communities will be collected by divers ( ...not me but the other members of my team). They will also characterise the different shapes of microbialite structures, as well as light conditions and photosynthesis activity of the lake environment.   We will also do light microscopy to study the cyanobacterial morphotype diversity.

 

Lake Fryxell at night

Fryxell.jpg

1

Most of the cyanobacterial mats that we have found were orange pigmented and the macroscopic structure was flaky to cohesive. The orange colour is due to carotenoids which are an protection against UV and oxidative stress.

 

I had a small light micrscope with me in the field and the genus Leptolyngbya dominated the orange mats. Leptolyngbya are filamentous non-branching cyanobacteria belonging to the order Oscillatoriales. They are mostly between 0.5-3 micrometre thick. However, the lower side of the orange layers sometimes had green pigmentation, which besides the Leptolyngbya also had some Phormidium. The genus Phormidium also belong to the order Oscillatoriales, but they are thicker with a width of around 5 micrometres.

 

   Flaky orange-pigmented cyanobacterial mats dominated by Leptolyngbya

Cyano1.jpg

 

Cohesive orange-pigmented cyanobacterial mats

Cyano2.jpg

 

green lower side of cyanobacterial mat with Phormidium

Cyano3.jpg

Interestingly, we also found some cyanobacterial mats which were dark purple to black. This colour is due to the UV-screening Scytonemin. We found the genus Schizothrix sp. (Oscillatoriales)  in the mats which is known to produce Scytonemin. We also found several ponds with large accumulations of the genus Nostoc, which belongs to the order Nostocales and has specialist cells called heterocysts for nitrogen-fixation.

 

Cyanobacterial mats with the Scytonemin-producing genus Schizothrix

Cyano5.jpg

 

Nostoc accumulations in a meltwater pond

Cyano4.jpg

 

We also found a few ponds with green algae. Green algae biofilms are easy to distinguish from cyanobacteria as green algae are very bright green.

                                                                                              

Green algae

Algae1.jpg

2

The Wright Valley is one of the ice-free Dry Valleys. The Upper Wright valley is characterised by the so-called Labyrinth, which is an area of steep-sided canyons and channels. It is mainly dolerite and most rocks are bright red. Based on the literature it was formed by large 'floods during the mid-Miocene era'.

 

The Labyrinth

 

laby1.jpg

 

In the area you can find many strangely shaped rocks. They are called ventifacts, and are wind- and dirt-sculpted rocks.

 

Ventifacts in the Labyrinth

 

laby3.jpg

 

Wherever you look you only see rocks and it often reminded me of images showing how it may look on Mars.

 

 

Landscapes like on Mars

laby2.jpg

However, there is life. On one of our walks, we found these lichens. They were on the top of one of the ridges, where the overall humidity seems to be higher due to its location at a height of greater than 750 metres, and the greater influence of clouds and fog. Many of the lichens grow under or in cracks of the rocks, and this enhances the erosion of the rocks.

 

 

Lichens on rocks in the Labyrinth

lichen.jpg

lichen2.jpg

lichen3.jpg

 

AND, as soon as you get running water and temporary ponds you get thick accumulations of orange-pigmented mats. To date there have only been few morphological descriptions and there is no DNA-based data available at all.

 

 

Meltwater ponds covered by ice with bright orange mats

pond1.jpg

pond4.jpg

 

 

Orange cyanobacterial-based microbial mats

pond2.jpg

 

 

Close-up of microbial mat

pond3.jpg

0

There are many small ponds and lakes at Cape Evans, similar to Cape Royds . After a quick survey of the ponds, we concentrated on five ponds for sampling. We sampled for morphological, DNA- and RNA-based analysis of the cyanobacterial diversity, as well as nutrient analysis of the water.

 

In one pond we found a pink coloured layer at the bottom of the mats, which is due to the presence of purple bacteria that  are anoxygenic phototrophs.


 



Cyanobacterial mats in Skua Lake

CEvans10.jpg


Large cyanobacterial mat accumulations

CEvans13.jpg



Cyanobacterial mat with a pink layer of purpil bacteria  at the bottom



CEvans14.jpg



Water sampling at a small pond at Cape Evans


CEvans11.jpg

0
Today, we went to Cape Evans, where the famous hut from the Terra Nova Expedition is located. The helicopter flight took 20 minutes and it was spectacular with great views over the the McMurdo Ice Shelf and sea ice. A group of conservators from the Antarctic Heritage Trust has been spending the whole summer here to work on the famous hut. They have a cosy camp with a communal kitchen and dining hut and several polar tents. Actually, these kind of tents were also used by Scott and their design has only little changed since then. They are can withstand stronger winds than mountain tents. From our lunch break we had a great view on Scott’s hut . After we were done with our sample collection the conservators from AHT showed us the hut.


Flight over the ice

CEvans1.jpg


Polar tents at Cape Evans

CEvans3.jpg

Scott's hut  build during the Terra Nova Expedition

CEvans4.jpg


Conservation work at the hut by Antarctic Heritage Trust

CEvans5.jpg

0

Yesterday we sampled cyanobacterial mats and water samples on the McMurdo Ice Shelf. We went for the day to an area near Bratina Island. In this area, the ice shelf  is covered with a  layer of sediment and hundreds of meltwater ponds can be found. During the summer they forms a large network of meltwater ponds  and it has the most extensive microbial growth and largest non-marine biota in southern Victoria Land. It  has been suggested that the  area plays an important role as  source for inocula through dispersal by winds into the more extreme regions such as the Dry Valleys.

 

Although some of the ponds are only several meters away from each other , they can have very different characteristics. A large range of salinities can be found in the area ranging from fresh to hypersaline.

 

 

 

                        McMurdo Ice Shelf and Bratina Island with Royal Society Range in the background

 

                         Bratina3.jpg

 

   Temperature, conductivity and ph measurements at an hypersaline pond near Bratina Island. The pond is called Salt Pond and has thick white salt crust around the water edge.

 

 

                         Bratina2.jpg

 

                                  Cyanobacterial mats with orange pigmented pinnacles

 

 

                                   Bratina1.jpg

0
The terrain surounding Cape Royds is covered with many ponds that vary in size, depth, shape and conductivity (salinity). There are also two larger lakes: Blue Lake and Clear lakes that are ice-covered all year. They were named during Shakleton’s expedition because of their blue and clear ice colour.  We were amazed by the variability of pond characteristics and diversity of microbial mats.



Back at the Natural History Museum we will study the cyanobacterial mats using microscopy and DNA-based tools to see if different mat types comprise different cyanobacterial communities.




                                             small pond with lift-off mats at Cape Royds

                                                 

                                                  CR_mats1.jpg


                                                                 Cyanobacteria-dominated mats

    

                                                  CR_mats2.jpg


                                                    CR_mats3.jpg

                                                                     

                             

1 2 Previous Next

Anne D Jungblut

Anne D Jungblut

Member since: Sep 2, 2010

I'm Anne Jungblut from the Botany Department. Join me as I head to Antarctica to study cyanobacterial diversity in ice-covered lakes of the Dry Valleys and Ross Island where already scientists on Scott's and Shakleton's expeditions made many discoveries.

View Anne D Jungblut's profile