Skip navigation
Currently Being Moderated

Summer student Josi has been working with Dr Anne Jungblut on the Museum's cyanobacteria collections. Here's her final post on cyanobacterial diversity.


Anne is already gearing up to head to Antarctica again! High time I wrap up my mini-series and show you my results. Last time, we sent the cyanobacterial samples for DNA sequencing. This is done in-house at the Museum, so it only takes a few days. Initially, the sequencing files are fairly innocuous - just long strings of letters representing the DNA code.

 

Here's an example of the first 50 letters of sample 1:

 

TGGAAACGGAACGCAGTCACATGTTTCGGCTGGACTCAGGGGTATCTAA…

 

The file continues like this for 770 more base pairs.

 

To get a first idea of  the easiest way to analyse such data is to carry out a BLAST search. BLAST stand for “basic local alignment search tool” and this is an online resource anyone can use. BLAST compares the uploaded sequences against a vast database.

 

In my case, the results are all cyanobacteria sequences that scientists have uploaded in the past. Under “query cover” you can see the percentage of identity between the sample and the database entry. In this particular case, we have a number of “uncultured cyanobacteria” entries, which means that somebody uploaded a sequence but didn’t add in much details. But the entry at the bottom shows a 99% match to Chamaesiphon, which is a unicellular cyanobacteria first described in the 1830s.

 

resize-13-11-14-1.jpg

Different Chamaesiphon genera © 2004–2014 J. Komárek & T. Hauer

 

resize-13-11-14-2.jpg

Microscopy images of cyanobacteria culture with highest BLAST match to Chamaesiphon.

 

 

In the image above you can see the sketch commonly found in scientific books on cyanobacteria for the order Chamaesiphon. Imagine having the microscope image on the top and using the drawings to try and identify the species - they don’t look too similar! Modern sequencing is a powerful tool to identify microorganisms.

 

However, BLAST results are not always straightforward. At times, the quality of the sequencing result isn’t good enough to carry out a good alignment or a sequence could correspond to more than one database entry. Sometimes, there is no entry to correspond to the uploaded sequence. This means that no similar DNA sequence has been uploaded to the BLAST database, and this may indicate a novel type of cyanobacteria. Therefore, for our case, further detailed phylogenetic analysis are now required to test if our preliminary BLAST result provided a correct assignment of the cyanobacterial isolate to the genus Chamaesiphon.

 

Sample9.jpg Samples13.jpg

 

 

 

 

 

 

 

 

 

Microscopy images of cyanbacteria isolates 9 and 13

 

 

 

 

 

Some of the other cyanobacterial isolates were samples 9 and 13. Sample 9 was sequenced and had 100% similarity to Phormidium priestleyi, while sample 13 had less certain results. In the case of sample 13, the sequence results itself is of low quality – a lower number of base pairs was analysed, and the signal intensity is very weak. This will either be due a low quality PCR-product or potentially a not pure cyanobacterial isolate.

 

After sequencing and BLAST, the next step is to carry out a phylogenetic analysis and to discuss the results in context of the metadata e.g. habitat, water chemistry etc to see if there are some common features. But sadly, my time at the Museum is over. I reckon there is still a lot do for another summer student !!!

Comments (0)
Anne D Jungblut

Anne D Jungblut

Member since: Sep 2, 2010

I'm Anne Jungblut from the Botany Department. Join me as I head to Antarctica to study cyanobacterial diversity in ice-covered lakes of the Dry Valleys and Ross Island where already scientists on Scott's and Shakleton's expeditions made many discoveries.

View Anne D Jungblut's profile

Bookmarked by (0)